Tuesday, October 16, 2012

Cultural Adaptations to Cold Climates


The cold is an environmental stress that negatively affects the survival of humans by disturbing homeostasis. As Carl Bergmann (1847) and Joel Allen (1877) observed physiological responses to climate, without the four standard ways to adapt juxtaposed with natural selection, humans will not survive the cold. For instance, cold weather negatively affects homeostasis with frostbite and hypothermia. Frostbite refers to the freezing of tissues. In order for skin to freeze temperatures are said to be 32 ºF which, once at the state, the dead skin will need to be surgically removed. Poorly insulated skin are found on the cheeks, nose, fingers, toes and earlobes. Inadequate blood circulation along with the low temperatures below freezing lead to frostbite. Next, Hypothermia not to be confused with hyperthermia is when the body’s core temperature (98-100 ºF) reaches 95.0 ºF for an extended time. When the body reaches this disruption in homeostasis, the brain becomes less efficient, consciousness is dulled, muscular rigidity begins and breathing becomes shallow: leads to eventual unconsciousness and possible death. 


Four ways in which humans have culturally adapted to the cold is by use of clothes, central air, diet, and tools. Varying from extreme to mild cold temperatures, insulated clothing styles are a way humans have adapted to the cold. As the image above depicts ideal clothing to use when on an expedition to Antarctica, one can get the sense of how important it is to adapt and how well humans have adapted to keeping homeostasis in the cold. 


Another way humans have culturally adapted to the stress of cold is through central air systems in modern homes. This image is an example how central heat systems are installed in homes that dissipate heat within a modern home, so a family can enjoy a peaceful evening in the middle of a blizzard in the state of Alaska by using a central heating system within the home. 


Moreover, diet is an important adaptation that humans have used to survive in the cold. Taking note from the Inuit tribe and Indians of Tierra del Fuego, consumption of large quantities of high calorie fatty foods is essential. Polar bear or seals is a great source of these fatty foods for the Inuit people. Their diets largely increases the basal metabolic rate which results in production of extra body heat. Since modern humans do not live in extreme cold, cultural adaptations to cold regarding diet can be seen in American consumption of chili or soup during the cold months.


Lastly, the unique ability for humans to create tools for survival is another way that they we adapted to the cold. Specifically, the Inuit are a great example of how the use of tools have allowed them to adapt to the cold. They have created a unique way to shield themselves for the “chill factor” while living in their extreme environment. This tool is known as snow.  The perpetual snow is used to build igloos by the Inuit. The snow is shaped by hand into big blocks and stacked together creating a domelike structure. Snow is used because the air pockets trapped in it make it an insulator; on the outside, temperatures may be as low as -49 °F, but on the inside the temperature may range from 19 °F to 61 °F when warmed by body heat alone. 

The benefit of studying human variation from this perspective across environment clines is gaining information that can be useful to help us in many ways. Knowledge is power. So with understanding how the body reacts in cold, for instance, can help how doctors react and treat patients with hypothermia or frostbite. One example would be when there is a natural disaster, the benefit of knowledge would help search and rescue teams to efficiently treat patients that are possibly on the verge of being hypothermic to regaining homeostasis. Using race to understand the variation of the adaptations listed previously is inaccurate. Since categorizations of people based upon skin color, face shape, nose shape, hair color, hair form, and eye color are viewed as human variation, most people typically use these categories to identify a “race.” However, these racial traits are not the only phenotypic factors to social identity. Sex and age play an importance in this as well. Yet, no matter what “race” one is labeled as, people are either female of male and are a certain age. Thus, that fact the race is interchangeably used with ethnicity shows how these phenotypes are closely related to cultural variables shows that race should not be used to understand the variation of the four adaptations addressed earlier.   Therefore, the study of environment influences on adaptation is a better way to understand human variation. When natural selection is considered, these influences become a great source of understanding. 

Tuesday, October 9, 2012

Doing Away With Verbal Communication


Engaging in a conversation for 15 minutes where the use of symbolic language is not allowed is extremely difficult. Not only does one have to make an effort to not use symbolic language, the person restricted has to find another way to communicate. Philosophical, scientific,  or any deep conversation regarding deep thinking is ruled out. When I was trying to communicate without any use of speaking, writing, or ASL, I could not communicate that the purpose for the exercise regarded my Anthropology 101 class. It was a difficult task to translate the word Anthropology. Although,  basic needs and wants were relatively easy to communicate. For instance, as I changed topics to wanting my needs met, I started to ask if I can have something to eat. Without saying anything, I was able to gesture that I wanted to eat. The person I was in conversation with was able to interpret my gestures by getting me a bag of chips to munch on. Another issue was that I was limited to a few select words that aided in my attainment of basic needs. For instance, when the person I was communicating with asked me what I wanted to for the rest of the evening, I was only able to indicate that I wanted my basic needs met (eat, sleep, laugh, etc . . .) Communicating specific activities was difficult: I could not have of stated that I would of liked to go out and watch Frankenweenie. The more complex the activity was that I attempted to communicate, the more difficult it was to gesture such descriptions. It goes to show how important and dependent modern hominins have become on the use of symbolic language to survive. Nonetheless, conversations without speaking, writing, or use of ASL is extremely difficult, and I am much more thankful for the ability to use symbolic language to communicate every day, at least in today’s modern culture. 

Even though the ability to not use symbolic language in communicating was difficult, the impressions of my partner in the conversation ranged from laughter to frustration (which was easily readable). At first the notation of such experiment was amusing. It took a little bit to get used to the awkwardness from communicating with speech to strictly communicating with gestures. For instance, the impression that my partner gave me, initially, was that of shy, embarrassing laughter because I was struggling to communicate a complex thought. The struggle was amusing to her, which she was not able to concentrate on my communication. Once that was over, I continued to communicate complex thoughts, but that quickly became an impotent process. As I was trying to communicate my plans for the day, like washing my car, washing the dishes, and going out at night, the impressions of my partner were that of confusion and frustration. As she had no clue what I was trying to say, she began to take control of the conversation by leading it with close ended questions. Questions that only required me to answer “yes” or “no” by nodding or shaking my head helped to ease the tension. The communication process became very simplistic, and complex thought was thrown out the window. I then began to address communicating my basic needs as a starting point, like I’m hungry, I’m tired, I’m bored, etc . . . This drove the conversation to alter my partner’s way of communicating by verbalizing my gestures and asking me questions to answers I originally gave: “I’m hungry,” “Are you hungry?”. 

If the experimental conversation represented two different cultures meeting for the first time, one culture would not have come out alive.  I believe through my findings, the advantage in communicating complex ideas has to go to those that use symbolic language. The ability to speak and write in direct result to complex ideas is, I believe, a major contributor to how H. erectus was able to outlive Neandertals. Even though I was able to express my basic needs, the ability to communicate a meaningful and emotional idea was lost. Thus, the basic form of communication called for basic topics within the conversation. I would presume that the speaking culture coming  into contact with the culture that does not use symbolic language would have more complex thoughts regarding the non-verbal culture. Those complex thoughts may have been feelings of superiority, astonishment/shock, or compassion. Whatever the attitudes were towards the non-speaking culture, I would be remise if not to say that the culture that could speak would have more complex ideas regarding those that could not speak. This idea is found in modern society. Sociology has developed the Sapir-Whorf Hypothesis that states learning a language develops a framework for understanding and interpreting social reality and the environment (Hammond and Cheney 43). In other words, having control and use of symbolic language allows for one to have complex sets of thought processes, allowing one an actual increase in cognitive capacity. Therefore, individuals in our culture that have difficulty communicating with spoken language—people who are deaf, mute, have different languages of their own outside of American culture—have learned to adapt and communicate to one another. One great example is how the deaf community has developed American Sign Language. The use of complex ideas has been able to be communicated through a complex system of gestures and facial expression that allow for one to use ASL to survive in our culture. ASL has affected our culture so much so that it has become a viable form of language taught in the school system across the nation.  People are learning to interact with deaf persons by either taking an ASL class or by writing down information. Nonetheless, complex ideas come from complex forms of symbolic communication. 

Conversing for 15 minutes without any physical embellishments was highly amusing. I was not able to fully communicate for 15 minutes using only speech because it simply was not natural to do so (we would start to laugh) . I would be very conscious of what I wanted to say, and I was able to fully use my speech to get my point across. Although, as I spoke in a monotone, there was no emotional connection to what I was saying. The form of communication was highly efficient in giving directions or answering to directions, but sharing emotions and sharing thoughts/ideas was not as interesting when communicating in every possible way. The lack of facial expressions and vocal intonation was highly uncomfortable when trying to communicate. 

Since this communication experiment was highly amusing for us, initially we both had a laugh at my form. As we progressed in the conversation, my partner would smirk and smile at me while I was talking. It go to the point that it became easier to speak when I did not look into her eyes. As I spoke while facing away from her, the conversation became much easier to manage. Yet, it quickly became impersonal. I wasn’t speaking as a person, but I was conversing as an informational  object. My partner noted that listening to me talk was like listening to a prerecorded automated person on a customer service support line: very impersonal and impractical. Therefore, through this experiment I found that non-speech language techniques in our ability to communicate effectively is extremely important. The experiment demonstrates that importance in human connection in language. Not only does the information communicated provide useful information about how to relate to the person, but the meniscal and subtle movements of the eyes or cheeks when saying “I love you,” or how the brow furrows and bends when saying "I don't understand," is a great example as to how one can reciprocate an emotion, thus allowing for the human connection to build a bond. I believe this relational bond whether it be plutonic or romantic is how modern hominins have been able to "stick together" to adapt and survive as a species. I believe that language has allowed for modern humans to be the only species that out lived other H. erectus. Thus, our symbolic language is why humans are still around today.  

Lastly, a person who has difficulty reading body language may have autism. According to the Autism Society, their site explains that “individuals with autism have difficulty reading nonverbal cues, including body language and the facial expressions of others” (“Bullying and Students”). The article continued to address the negative drawback to not reading body language by analyzing the affects when a student with autism is being bullied: they sometimes may take sarcastic remarks literally. Thus, the adaptive benefit in possessing the ability to read body language can save a life from a perhaps deadly confrontation. When Neanderthals and H. Erectus communicated with each other, a possible scenario may risen where body language might have saved the lives of either party. The ability to read body language can be signals to a possible life threatening attack. Although, not reading body language may be a benefit in an environmental condition. For instance, if people did not read body language, there would be no such thing as first impressions. The first ten-seconds of meeting someone for the first time is said to be read by body language; these few seconds may make or break a career or a possible long lasting relationship. Therefore, not reading body language can allow for people that meet for the first time the benefit of the doubt by allowing for a relationship to be set before one is dismissed from getting a job or finding a possible mate. Nonetheless, body language is inseparable from symbolic language, and is extremely important in today’s culture and society. 

Tuesday, September 25, 2012

“Two things are infinite: the universe and human stupidity, and I’m not sure about the universe.” -Albert Einstein






The Piltdown Man in Piltdown, England was discovered by Charles Dawson, an amateur archaeologist hungry for the “missing link” as he writes about his discovery on February 14, 1912 of the skull found.  For the next 40 years the skull is revered to be and perceived to be the fossil that connects humans with apes until a startling discovery was made. It was a fossil that was looked at, analyzed, and accepted to be over half a million years old by British scientists and scientists from around the world. The reputation of Dawson and his colleague, Sir Arthur Smith Woodward, reached a new global level. They aided British scientists to claim that England was in the competition of identifying details of human evolution against Germany’s “Neanderthal” and Spain’s and France’s evidence of early man, as well. The race was on. Although, it only lasted for 40 years. The startling discovery took place within Britain’s Natural History Museum when Kenneth Oakley applied a chemical test that was finally used to test the age of the skull. The test dated the skull to be  a lot younger than expected: it was a “phony.” The skull was stained to appear primitive, with the teeth filed down, and the jaw was from an old ape. It was devastating in and to the science community.  British scientist were embarrassed, to say the least. The blame game was on as British scientists were picking up what is left of their shattered careers. 

The human faults that come into play in this scenario which negatively affect the scientific process by the highlighting bias within science are egotism, pride, and rivalry. Egotism was clearly found in how Dawson and Woodward were so eager to show the world how their new discovery. Eventually, Dawson’s collection of artifacts that he claimed to be from antiquity were dismissed as frauds after the Piltdown hoax was revealed to the world. Woodward was the most eminent scientist at the Natural History Museum in Britain that his egotism was never questioned, it was allowed and praised. These two instances show how egotistical Dawson and Woodward were. With this information the science behind the discovery was based on a bias for fame which affected the scientific process for 40 years. Pride was another human fault exemplified in this scenario. Pride held back the fraudulent activity from the culprit confessing his or her wrong doing. There could have been many careers salvaged if the culprit allowed themselves to confess; although, easier said than done. Pride, specifically, spread throughout Britain. Britain was ecstatic that they had a primitive human fossil that they were blinded by not being more critical against Dawson and Woodward. Why wasn’t the fossil scientifically dated when it was found? The bias of pride became cancerous within the scientific community. Lastly, rivalry was a fierce human fault. The rivalry (W. W. I) between countries is one. However, another vicious rivalry was in the Museum between Woodward, department head of paleontology, and Martin Hinton, a fossil expert who eventually rose to become the department head of zoology. There are many signs that point toward Hinton in his knowing of the forgery, yet he never came out to acknowledge it. His skepticism fueled the dissension between them. Woodward’s status and unwillingness to believe otherwise kept the discovery undisputed. Woodward’s bias, specifically, may have just been what drove the hoax to last for so long. Nonetheless, the complexities and faults of human nature has and inevitably is involved in the scientific process. 

The positive aspect of the scientific process that was responsible for revealing the skull to be a fraud was a method of relative dating: fluorine analysis. According to the textbook Introduction to Physical Anthropology, the authors describe that a fluorine analysis in bones found in the same location that are believed to be primitive aid in deciphering the relative age between them through the amount of fluorine found in the fossil: the longer the bones lie, the more fluorine it contains (294). Therefore, as the textbook continues to allude to, Professor Kenneth Oakley used this method to analyze the skull with the jaw bone found at the Piltdown site. He found that the skull had a difference of fluorine when compared to the jaw bone. This discrepancy of fluorine content led him and other scientists to investigate and find that the jaw bones was from an orangutan. His fluorine analysis of the bones was the positive aspect of the scientific process for revealing the skull to be a fraud. 

I believe that to remove the human factor from science to reduce the chance of errors is highly unlikely; in fact, it is impossible. As some may argue that humans were made in the likeness of God, they are not perfect. People make mistakes, its in our nature. Even the most revered make mistakes. For instance, Albert Einstein once said that “Two things are infinite: the universe and human stupidity, and I’m not sure about the universe.” Therefore, the theory of a flat Earth was subject to “human stupidity,” yet trial and error has shaped modern science to flourish in explaining phenomenons found in the universe. I would not want to remove the human factor from science because maybe we are no supposed to know everything, thus our “stupidity” holds us back from omnipotence. As the saying goes, be careful what you wish for, you might just get it. This to me can be a negative thing. 

Unlike the scientists in Britain when the Piltdown discovery was announced, a lesson that I take from this historical event regarding taking information at face value from unverified sources is that it does not matter who offers information, research and understand the information before taking a firm stand on it. For instance, evolution in the media is something that is always referred to as controversial, yet there is no concrete information provided on it that may allude to the controversy. Creationism and evolution are in direct conflict with each other, why? Taking this class has enlightened me on the mechanisms of evolution, but in order for me to take a firm stand for or against it, I must research and understand argument from creationists. It is only fair for me to make an informed decision before finding out 40 years later that I made a mistake. 

Wednesday, September 19, 2012

The Five Primates

     As there are a number of environmental and physiological variables within the principles of behavioral evolution, studying primates whose behavior is unaffected by human activities will help discover fundamental behavioral principles (184). Therefore, comparing the social and mating patterns of lemurs, spider monkeys, baboons, gibbons, and chimpanzees will gain one an evolutionary perspective by using the behavioral ecology approach. First, a thorough description of the environment in which the primates live is essential to understand behavior: social and mating patterns. Take the lemurs for instance, found in the suborder as Strepsirhini. They have an extremely restricted range of habitual life, exclusively to the island of Madagascar and the Comoro Islands; lemurs do not have competition from the more advanced non-human primates. Next are the spider monkeys (New World monkeys) in the Ceboidea superfamily, which are limited to tropical forest environments of southern Mexico, Central and South America. They are predominantly arboreal (meaning they live in trees), and they are herbivores that love the minimally fluctuating tropical temperature .  Baboons (Old World monkeys) belong to the Cercopithecoidea superfamily within the Haplorhini suborder of the primate order, and they live in Africa and Asia. They inhabit a range of environments: tropical rain forest, savanna, shrub land, mountainous terrain. They are also found surviving in Gibraltar, south of Spain. By tending to live in trees, they are also known to be terrestrial quadrupeds. Fourth, the gibbon (lesser ape) from the Hylobatidae family inhabit the tropical and subtropical rainforest from northeast India to Indonesia, as well as northern and southern China, Sumatra, Borneo, and Java. Gibbons have mastered brachiation (swinging from tree limb to tree limb), in which they are known as the fastest non-flying mammals that live in the trees. Lastly, chimpanzees (Great ape) are considered to be within the Hominidae family; they are colloquially referred to as “chimps.” Under the genus Pan, they live in tropical forests and wet savannas of Western and Central Africa and in the forests of the Democratic Republic of the Congo (DRC).


Lemur (Prosimians/Strepsirhini)


     Each of these environments influence the primates’ behaviors, respectively. For instance, lemurs are known to be extremely sociable. The ring-tailed lemurs, for example, are found in groups of up to 25, and they spend most of the day on the ground, than in the trees. Also unlike the other primates to follow, females generally dominate males in lemur social interactions. They are arboreal and omnivorous as they are also nocturnal as opposed to monkeys and apes, which allows them to develop a niche when hunting for insects, eggs, and baby birds. Lemurs have a breeding season instead of an individual cycle. When the annual mating season occurs, which consists of several days, males fight with each other for access to the groups of promiscuous females as the females each are sexually receptive for only one day.  


Spider Monkey (New World Monkey/Platyrrhini)


     Next, the male spider monkeys have stronger bonds when compared to their female relationships; therefore, when females go through puberty, they disperse to join new groups. Yet, the strongest social bonds form between females and young offspring. Groups are led by a female in the daily routine of feeding activities. Spider monkeys are diurnal, and they don’t view grooming as an important social interaction. This may be due to a lack of thumbs. Spider monkeys mate year-round. Female monkeys choose a male from her group to mate with. Once a possible mate is picked, they each sniff their mates to check their readiness for copulation, known as anogential sniffing. Mothers are extremely protective of their young, and the males have part in raising of offspring. 


Baboon (Old World Monkey/Cercopithecidae)


     Baboons are very social. The smallest size group has about 50 members, and they can easily reach up to 250 members. They are complex in the way they form subgroups to help keep things from becoming chaotic. The organization of groups allows for subcultures to arise amongst them, and they have a lot of social activity. They spend time chattering among themselves, which can sound very loud and chaotic when in their environment. This brings comfort and safety to the group. Baboon males tend to be plentiful and extremely dominant to which they have several females in their harems. When the females are in esterus, their sexual skins or swellings are hairless and large swollen patches of skin around the genital that entices male baboons. Males are often fighting over the females that they want to be part of their harems. 


Gibbon (Lesser ape/Hylobatidae)


     Gibbons live in similar nuclear families, compared to humans. Gibbons are monogamous, and their communities consist of adults and their offspring. They rarely go down to the forest floor as they live in the tree tops. They are always defending their territory against other species with loud whooping and hooting vocalizations, much like howler monkeys. As they are very social animals, their vocal capabilities aid them in gaining their mate. Males tend to sing solos to attracts mates and advertise their territories. If a male and female like each other’s song, they’ll find each other. They’ll start their mating ritual of a short mating dance that leads to a vigorous mating ritual for about three days, in which they’ll mate about five-hundred times in this period. 


Chimpanzee (Great ape/Hominidae)


     Chimpanzees typically live in communities of about 20 to more than 150 members although they spend most of their travel time with a small parties or a few individuals. The Common Chimpanzee lives in a fission-fusion society: mating is promiscuous. The male is the core of the societies in which they roam around, protect, and search for food. There is a dominance hierarchy among males, yet the fission-fusion social structure allows for an intermixing of smaller groups on a daily basis. These smaller groups allow for different purposes. A male group is used to hunt for meat; a bisexual group (one male and one female) copulate; an individual may also be left to forage alone: the structure of their societies are highly complicated. There is no mating season, so when female chimpanzees go off in separate directions to forage for fruit, they may often mate with other subordinate males, whether by choice or not.

     Nevertheless, these five primates’ social and mating patterns have been influenced by their environments; these traits can be viewed as an adaptation to the primates’ habitat. Take the lemurs, for instance, since they are secluded on Madagascar, their competition for their environmental niche has evolved them to become diurnal. This allows them to avoid competition and predation as they forage freely for food. Their mating rituals, as well, show that males fighting males has allowed them a development of testosterone to compete for the limited resource of females, thus allowing them to reproduce/evolve. The spider monkeys spend their lives in the tropical trees defending their territory from threats by twisting and breaking of large and heavy branches close to their threats. This evolutionary adaptation has allowed them to remain in the trees as well as create a dynamic environment for the trees to continue to grow and evolve, as well. The baboons have developed large sexual skin, thus allowing them to reproduce dominant traits within the dominant baboon genetics that tend to favor bigger and smellier sexual skins from females, thus allowing the species to evolve as a dominant species. Gibbons have developed and the brachiating masters, thus their arms have evolved to assist this need as they live high up in the trees. Lastly, chimpanzees have develop subgroup organization because of the large environment that they occupy. In order for them to survive and thrive, working together in their environment is an example of their evolutionary adaptation. 

Thursday, September 13, 2012


Homology and Analogy



In the pictures above, all of these species possess the ability to swim under water with the use of a variety of adaptations. They each, specifically, share two side fins that aid in maneuverability in the water. Dolphins and the whales are homologous because they anatomically posses bones in their pectoral fins that are very similar to the human arm. According to Smithsonian Institution, dolphins and whales use their pectoral fins to steer and guide through the water, and they both have the major skeletal elements of the forelimbs of land mammals. These homologous traits exhibit difference between the two species because the fins are shortened and modified compared to each mammal due to their size and environment. According to the University of Bristol, these Cetacea are considered to be descendants of land mammals, largely due to the bones found in the fins and their need to breathe air from the surface. Also, the University of Bristol states that whales and dolphins were close relatives to the largest hoofed carnivores on land known as Rodhocetus. 
As compared to dolphins, sharks possess the analogous pectoral fins. Although, sharks use their pectoral fins to maneuver up while swimming. Sharks are considered fish and not mammals; therefore, their fins are rigid, not flexible, and the fins are supported by rods made of cartilage, according to PBS.org. In this way their fins are analogies. Sharks are classified as Chondrichthyes (jawed fish with paired fins). They first appeared 450 may, and they have no bones. Their skeletal structure is made up of cartilage. As sharks have remained in equilibrium for a large amount of time, their ancestors have shared the analogous trait of pectoral fins. 


Thursday, September 6, 2012

What does this DNA like to do?





GTTTACCAACCGAACGTAAGTGTTCCGACCCTGGCGTGAGTCTGTTGGCCATGCATCCGA


Wednesday, August 29, 2012

Charles Darwin's Greatest Influence




Thomas Malthus (1766-1834) had the most positive influence over Darwin’s development of his theory of natural selection. According to the University of California Museum of Paleontology, Malthus’ work in An Essay on the Principle of Population sparked a missing component in Darwin’s view on evolution which Darwin later called it natural selection (“Thomas Malthus”). Malthus was equating his view that overpopulation in mankind is inevitable if left unrestrained to his observation that in nature overproduction is also evident in plants and animals. Famine and poverty among Man is a natural force, according to Malthus, that causes a need for regulation. 

Thus, Darwin independently became positively affected by developing what the sixth point says about how the ever changing environment causes evolvement in traits to help adapt: the whole mechanism of natural selection was influenced by this idea. The evidence that Darwin was influenced by Malthus exponentially is viewed in his autobiography where he states that by reading Malthus’s essay “got a theory” to work with (“Thomas Malthus”). The textbook states that Darwin was able to recognize that competition would then derive from the state of limited resources, and competition between individuals drives as key to the mechanism of natural selection (34). 

Darwin’s genius was also hindered because without the help of Malthus’ works, Darwin could not have developed this theory. If a single person was to understand the complexities to which humankind operates under, there would be no need to seek understanding. Humans are not all knowing, so we need help from other like-minded people to collaborate with and share ideas. In Darwin’s case, Malthus was that like-minded figure. 

In addition, Darwin understood the controversy of his discovery, which was directly linked to the attitude of the church. This aided Darwin in delaying his publication of his book, On the Origin of Species.  The textbook recounts how Darwin, not only felt he had insufficient data, but understood that publishing his hypothesis would contradict the church’s belief system in creationism (39). He held off from publishing his work until Alfred Russel Wallace simultaneously came to the similar conclusion about natural selection (also influenced by Malthus’ work), so Darwin published his work wanting the credit to go to himself. Darwin revolutionized evolution theory with the mechanism of natural selection, which was heavily influenced by Thomas Malthus.