“Two things are infinite: the universe and human stupidity, and I’m not sure about the universe.” -Albert Einstein

The Piltdown Man in Piltdown, England was discovered by Charles Dawson, an amateur archaeologist hungry for the “missing link” as he writes about his discovery on February 14, 1912 of the skull found.  For the next 40 years the skull is revered to be and perceived to be the fossil that connects humans with apes until a startling discovery was made. It was a fossil that was looked at, analyzed, and accepted to be over half a million years old by British scientists and scientists from around the world. The reputation of Dawson and his colleague, Sir Arthur Smith Woodward, reached a new global level. They aided British scientists to claim that England was in the competition of identifying details of human evolution against Germany’s “Neanderthal” and Spain’s and France’s evidence of early man, as well. The race was on. Although, it only lasted for 40 years. The startling discovery took place within Britain’s Natural History Museum when Kenneth Oakley applied a chemical test that was finally used to test the age of the skull. The test dated the skull to be  a lot younger than expected: it was a “phony.” The skull was stained to appear primitive, with the teeth filed down, and the jaw was from an old ape. It was devastating in and to the science community.  British scientist were embarrassed, to say the least. The blame game was on as British scientists were picking up what is left of their shattered careers. 

The human faults that come into play in this scenario which negatively affect the scientific process by the highlighting bias within science are egotism, pride, and rivalry. Egotism was clearly found in how Dawson and Woodward were so eager to show the world how their new discovery. Eventually, Dawson’s collection of artifacts that he claimed to be from antiquity were dismissed as frauds after the Piltdown hoax was revealed to the world. Woodward was the most eminent scientist at the Natural History Museum in Britain that his egotism was never questioned, it was allowed and praised. These two instances show how egotistical Dawson and Woodward were. With this information the science behind the discovery was based on a bias for fame which affected the scientific process for 40 years. Pride was another human fault exemplified in this scenario. Pride held back the fraudulent activity from the culprit confessing his or her wrong doing. There could have been many careers salvaged if the culprit allowed themselves to confess; although, easier said than done. Pride, specifically, spread throughout Britain. Britain was ecstatic that they had a primitive human fossil that they were blinded by not being more critical against Dawson and Woodward. Why wasn’t the fossil scientifically dated when it was found? The bias of pride became cancerous within the scientific community. Lastly, rivalry was a fierce human fault. The rivalry (W. W. I) between countries is one. However, another vicious rivalry was in the Museum between Woodward, department head of paleontology, and Martin Hinton, a fossil expert who eventually rose to become the department head of zoology. There are many signs that point toward Hinton in his knowing of the forgery, yet he never came out to acknowledge it. His skepticism fueled the dissension between them. Woodward’s status and unwillingness to believe otherwise kept the discovery undisputed. Woodward’s bias, specifically, may have just been what drove the hoax to last for so long. Nonetheless, the complexities and faults of human nature has and inevitably is involved in the scientific process. 

The positive aspect of the scientific process that was responsible for revealing the skull to be a fraud was a method of relative dating: fluorine analysis. According to the textbook Introduction to Physical Anthropology, the authors describe that a fluorine analysis in bones found in the same location that are believed to be primitive aid in deciphering the relative age between them through the amount of fluorine found in the fossil: the longer the bones lie, the more fluorine it contains (294). Therefore, as the textbook continues to allude to, Professor Kenneth Oakley used this method to analyze the skull with the jaw bone found at the Piltdown site. He found that the skull had a difference of fluorine when compared to the jaw bone. This discrepancy of fluorine content led him and other scientists to investigate and find that the jaw bones was from an orangutan. His fluorine analysis of the bones was the positive aspect of the scientific process for revealing the skull to be a fraud. 

I believe that to remove the human factor from science to reduce the chance of errors is highly unlikely; in fact, it is impossible. As some may argue that humans were made in the likeness of God, they are not perfect. People make mistakes, its in our nature. Even the most revered make mistakes. For instance, Albert Einstein once said that “Two things are infinite: the universe and human stupidity, and I’m not sure about the universe.” Therefore, the theory of a flat Earth was subject to “human stupidity,” yet trial and error has shaped modern science to flourish in explaining phenomenons found in the universe. I would not want to remove the human factor from science because maybe we are no supposed to know everything, thus our “stupidity” holds us back from omnipotence. As the saying goes, be careful what you wish for, you might just get it. This to me can be a negative thing. 

Unlike the scientists in Britain when the Piltdown discovery was announced, a lesson that I take from this historical event regarding taking information at face value from unverified sources is that it does not matter who offers information, research and understand the information before taking a firm stand on it. For instance, evolution in the media is something that is always referred to as controversial, yet there is no concrete information provided on it that may allude to the controversy. Creationism and evolution are in direct conflict with each other, why? Taking this class has enlightened me on the mechanisms of evolution, but in order for me to take a firm stand for or against it, I must research and understand argument from creationists. It is only fair for me to make an informed decision before finding out 40 years later that I made a mistake. 

The Five Primates

     As there are a number of environmental and physiological variables within the principles of behavioral evolution, studying primates whose behavior is unaffected by human activities will help discover fundamental behavioral principles (184). Therefore, comparing the social and mating patterns of lemurs, spider monkeys, baboons, gibbons, and chimpanzees will gain one an evolutionary perspective by using the behavioral ecology approach. First, a thorough description of the environment in which the primates live is essential to understand behavior: social and mating patterns. Take the lemurs for instance, found in the suborder as Strepsirhini. They have an extremely restricted range of habitual life, exclusively to the island of Madagascar and the Comoro Islands; lemurs do not have competition from the more advanced non-human primates. Next are the spider monkeys (New World monkeys) in the Ceboidea superfamily, which are limited to tropical forest environments of southern Mexico, Central and South America. They are predominantly arboreal (meaning they live in trees), and they are herbivores that love the minimally fluctuating tropical temperature .  Baboons (Old World monkeys) belong to the Cercopithecoidea superfamily within the Haplorhini suborder of the primate order, and they live in Africa and Asia. They inhabit a range of environments: tropical rain forest, savanna, shrub land, mountainous terrain. They are also found surviving in Gibraltar, south of Spain. By tending to live in trees, they are also known to be terrestrial quadrupeds. Fourth, the gibbon (lesser ape) from the Hylobatidae family inhabit the tropical and subtropical rainforest from northeast India to Indonesia, as well as northern and southern China, Sumatra, Borneo, and Java. Gibbons have mastered brachiation (swinging from tree limb to tree limb), in which they are known as the fastest non-flying mammals that live in the trees. Lastly, chimpanzees (Great ape) are considered to be within the Hominidae family; they are colloquially referred to as “chimps.” Under the genus Pan, they live in tropical forests and wet savannas of Western and Central Africa and in the forests of the Democratic Republic of the Congo (DRC).

Lemur (Prosimians/Strepsirhini)

     Each of these environments influence the primates’ behaviors, respectively. For instance, lemurs are known to be extremely sociable. The ring-tailed lemurs, for example, are found in groups of up to 25, and they spend most of the day on the ground, than in the trees. Also unlike the other primates to follow, females generally dominate males in lemur social interactions. They are arboreal and omnivorous as they are also nocturnal as opposed to monkeys and apes, which allows them to develop a niche when hunting for insects, eggs, and baby birds. Lemurs have a breeding season instead of an individual cycle. When the annual mating season occurs, which consists of several days, males fight with each other for access to the groups of promiscuous females as the females each are sexually receptive for only one day.  

Spider Monkey (New World Monkey/Platyrrhini)

     Next, the male spider monkeys have stronger bonds when compared to their female relationships; therefore, when females go through puberty, they disperse to join new groups. Yet, the strongest social bonds form between females and young offspring. Groups are led by a female in the daily routine of feeding activities. Spider monkeys are diurnal, and they don’t view grooming as an important social interaction. This may be due to a lack of thumbs. Spider monkeys mate year-round. Female monkeys choose a male from her group to mate with. Once a possible mate is picked, they each sniff their mates to check their readiness for copulation, known as anogential sniffing. Mothers are extremely protective of their young, and the males have part in raising of offspring. 

Baboon (Old World Monkey/Cercopithecidae)

     Baboons are very social. The smallest size group has about 50 members, and they can easily reach up to 250 members. They are complex in the way they form subgroups to help keep things from becoming chaotic. The organization of groups allows for subcultures to arise amongst them, and they have a lot of social activity. They spend time chattering among themselves, which can sound very loud and chaotic when in their environment. This brings comfort and safety to the group. Baboon males tend to be plentiful and extremely dominant to which they have several females in their harems. When the females are in esterus, their sexual skins or swellings are hairless and large swollen patches of skin around the genital that entices male baboons. Males are often fighting over the females that they want to be part of their harems. 

Gibbon (Lesser ape/Hylobatidae)

     Gibbons live in similar nuclear families, compared to humans. Gibbons are monogamous, and their communities consist of adults and their offspring. They rarely go down to the forest floor as they live in the tree tops. They are always defending their territory against other species with loud whooping and hooting vocalizations, much like howler monkeys. As they are very social animals, their vocal capabilities aid them in gaining their mate. Males tend to sing solos to attracts mates and advertise their territories. If a male and female like each other’s song, they’ll find each other. They’ll start their mating ritual of a short mating dance that leads to a vigorous mating ritual for about three days, in which they’ll mate about five-hundred times in this period. 

Chimpanzee (Great ape/Hominidae)

     Chimpanzees typically live in communities of about 20 to more than 150 members although they spend most of their travel time with a small parties or a few individuals. The Common Chimpanzee lives in a fission-fusion society: mating is promiscuous. The male is the core of the societies in which they roam around, protect, and search for food. There is a dominance hierarchy among males, yet the fission-fusion social structure allows for an intermixing of smaller groups on a daily basis. These smaller groups allow for different purposes. A male group is used to hunt for meat; a bisexual group (one male and one female) copulate; an individual may also be left to forage alone: the structure of their societies are highly complicated. There is no mating season, so when female chimpanzees go off in separate directions to forage for fruit, they may often mate with other subordinate males, whether by choice or not.

     Nevertheless, these five primates’ social and mating patterns have been influenced by their environments; these traits can be viewed as an adaptation to the primates’ habitat. Take the lemurs, for instance, since they are secluded on Madagascar, their competition for their environmental niche has evolved them to become diurnal. This allows them to avoid competition and predation as they forage freely for food. Their mating rituals, as well, show that males fighting males has allowed them a development of testosterone to compete for the limited resource of females, thus allowing them to reproduce/evolve. The spider monkeys spend their lives in the tropical trees defending their territory from threats by twisting and breaking of large and heavy branches close to their threats. This evolutionary adaptation has allowed them to remain in the trees as well as create a dynamic environment for the trees to continue to grow and evolve, as well. The baboons have developed large sexual skin, thus allowing them to reproduce dominant traits within the dominant baboon genetics that tend to favor bigger and smellier sexual skins from females, thus allowing the species to evolve as a dominant species. Gibbons have developed and the brachiating masters, thus their arms have evolved to assist this need as they live high up in the trees. Lastly, chimpanzees have develop subgroup organization because of the large environment that they occupy. In order for them to survive and thrive, working together in their environment is an example of their evolutionary adaptation. 

Homology and Analogy

In the pictures above, all of these species possess the ability to swim under water with the use of a variety of adaptations. They each, specifically, share two side fins that aid in maneuverability in the water. Dolphins and the whales are homologous because they anatomically posses bones in their pectoral fins that are very similar to the human arm. According to Smithsonian Institution, dolphins and whales use their pectoral fins to steer and guide through the water, and they both have the major skeletal elements of the forelimbs of land mammals. These homologous traits exhibit difference between the two species because the fins are shortened and modified compared to each mammal due to their size and environment. According to the University of Bristol, these Cetacea are considered to be descendants of land mammals, largely due to the bones found in the fins and their need to breathe air from the surface. Also, the University of Bristol states that whales and dolphins were close relatives to the largest hoofed carnivores on land known as Rodhocetus. 

As compared to dolphins, sharks possess the analogous pectoral fins. Although, sharks use their pectoral fins to maneuver up while swimming. Sharks are considered fish and not mammals; therefore, their fins are rigid, not flexible, and the fins are supported by rods made of cartilage, according to PBS.org. In this way their fins are analogies. Sharks are classified as Chondrichthyes (jawed fish with paired fins). They first appeared 450 may, and they have no bones. Their skeletal structure is made up of cartilage. As sharks have remained in equilibrium for a large amount of time, their ancestors have shared the analogous trait of pectoral fins. 

What does this DNA like to do?

GTTTACCAACCGAACGTAAGTGTTCCGACCCTGGCGTGAGTCTGTTGGCCATGCATCCGA